Skip to main content

Table 1 Primer sequences for real-time PCR

From: Anti-inflammatory effects of Jingshu Keli capsule and its components on human synoviocyte MH7A cells

GeneForward primer (5′ → 3′)Reverse primer (5′ → 3′)
IL-6CCTGACCCAACCACAAATGCATCTGAGGTGCCCATGCTAC
IL-8GGTGCAGTTTTGCCAAGGAGTTCCTTGGGGTCCAGACAGA
TNF-αCCCCAGGGACCTCTCTCTAATCGGTTTGCTACAACATGGGCTACA
GAPDHGGAGTCCACTGGCGTCTTAGGCTGTTGTCATACTTCTCAT